In the first installment…
What I tried to show is that through various psychological/biological processes we create internal mental symbols – names - from the flux of sensory constellations gathered from the external world. This process is so automatic and well greased that we can easily forget that these symbols, mushroom names in this case, have been abstracted from the reality from which they spring. In that article, I applied those concepts to naturalistic observation, but a case can be made that they are central to more 'objective' taxonomies as well.

In this installment, we will look at the cognitive end of the perceptual-cognitive continuum: memory and meaning in the identification process, the role of operational definitions in establishing specific referents for the precise meanings of our conceptual constructs, and the role of language in mediating our notions of reality.

Memory and Meaning: the Conceptual Frontier
Once past the processes of sensation and perception, the electrochemically encoded neural circuitry of the brain morphs into the territories of Memory and Meaning. It is this rich tapestry, probably more than any other, that gives shape and substance to our world. It is here where the durable mental constructs of symbol and concept shape, define, and give structure to that “booming buzzing confusion”, as William James put it, which constitutes our unprocessed external world.

In cognitive psychology, the Memory Process is often broken into three stages, each occurring in a different part of the brain. The stages are called, Perceptual, Short Term, and Long Term Memory. Let’s have a look. (Wood and Wood 1996)

Perceptual Memory (often called the Sensory Store) occurs in the layers of brain tissue we call the retina (the neural circuitry of which is said to be as rich, complicated, and as powerful as that of a huge mainframe or super computer). The amount of information striking the retina is enormous, some say “infinite”, a term, I take it, that is meant in a figurative sense. However large it may be, information passing through this sensory store is subject to rapid decay. It is gone in a split second. Neglected it is lost. Arrested it is encoded and passed along to STM. Attention is the bright light that arrests sensation and captures an image. As used here it might be considered the spark that lights the fuse of consciousness. (Sperling 1960)

Short Term Memory (STM) It has long been known that the hippocampus and nearby subiculum, primitive parts of what some call the Medial Temporal Lobe, were responsible for fixing memory in our minds. Recent evidence indicates that they are activated immediately upon transfer of information from the Sensory Store. (Deadwyler, and Hampson 2004) In humans, the processing of declarative (verbal) memories occurs as these structures interact with other parts of the brain. This is the hub of what we usually think of as consciousness - those things that are on our mind at the moment. (Hippocampal activity and growth is also observed in other animals such as chipmunks and squirrels when they collect and store food and presumably lay down memories of where it is stored, a process called procedural memory).

STM is capable of holding only 7 + 2 elements, a fact discovered in Bell Laboratories and, in case you were wondering, the reason for our seven digit telephone number. Typically memories are held here for a matter of minutes. If processed, usually by repetition, these memories are consolidated and passed along to higher brain centers in the cerebral cortex, as long term memory. (STM in Wiki)

Memories sent to the Long Term Memory Bank (LTM), (the Temporal and Frontal lobes of the cerebral cortex) are considered “permanent” and also “infinite” although both terms are probably best thought of as figurative rather than literal. Here they are stored chemically, in neural tracks. More about this later.

Five to Nine: Seven, plus or minus two items:
The magic number of 7+2 deserves special comment, for it is this brittle size, rather than the deeper structure of memory that is important at this stage of the continuum.(See Miller in Wiki) Consider STM the narrow waist of an hourglass. “Infinite” information occurs both upstream and down, but here a mere trickle of between five and nine items is all that can be processed, regardless of whether the information comes in afresh from our perceptions (the mushroom we hold in our hand) or is recalled from long term memory (the image or idea of a species concept held in out mind). In either case only 7+2 items can be processed by the conscious mind at any one time.

Worry about a job promotion and you are down to 6 +2. Thinking about dinner, and of your dinner partner? Now you have only 4 channels open. Attend to the ache in your back, or your heart, and you are operating at half speed.

To the extent, however, that these items can be repackaged, “chunked” from bits to bytes, from concrete images into abstract symbols, or from simple isolated facts to rich concepts, we develop our human capability of abstract thought. Symbolical, conceptually based thought allows us to handle 7 powerful ideas, rather than 7 discrete bits of an observation. It is easy to see how these dynamic processes contribute to our ability to name and identify mushrooms.

Consider, for example, the interaction between an active mind, say one trying to work out the details of a complex set of binomial couplets, and the gathering of observations from the specimen at hand. To the extent that I am unfamiliar with the meaning of the terms being used, I am less likely to actually see them, think about them, and use them in the identification of the mushroom.

Personally, I am most aware of the workings of Perceptual Memory with the fleeting glimpses of tissue and structures viewed under a microscope, particularly at high resolution and with digital image processing. Using a simple squash mount, I might start by looking for basidia and spores, but as my right hand moves the stage and my left works the focus oodles and oodles of images flit across my retina. If I know that medallion clamps are important in either confirming or ruling out identification I am more likely to notice them as they zip by way out in a corner of my vision under two other layers of tissue. The same with a plage, pore, trichoderm, or skeletal hyphae. (see Largent for illustrations)

Jelly fungi; out of the soup and under the scope
For a graduate class in mycology, I once brought a collection of Tremella foliacea, a species which is quite common in the Catskill Mountains. It was getting late in the fall semester and the collecting was limited. The specimens were fresh, and the Professor was Chinese, young energetic and very engaging.

Tremella foliacea is a jelly fungus. So is Auricularia auricula, the Tree Ear Mushroom. Both have basidia that are divided into segments; Phragmobasidiomycetes. If you have ever looked at these under a microscope you were probably amazed at how few hyphae there actually are amidst the gelatinous matrix.

Well, members of the class all were preparing mounts of the fresh jellies, the professor included and he was waxing eloquent about the gelatin, the fragmented basidia, the wonderful blood thinning properties and taste of these mushrooms, which he had identified as Tree Ears, Auricularia. Thinking I had made a mistake I looked and looked for the transverse, horizontally divided basidia of Auricularia, and suddenly, quite unexpectedly, one appeared with longitudinal walls and long sterigma (of foliacea) only to dissolve immediately, dropping out of the visual plane I was scanning. It was like a small electric jolt, and I was able to backtrack and locate it again. The only problem remaining was to find a diplomatic way to call this find to the teacher’s attention. After about 10 minutes such an occasion presented itself and I asked his opinion of my sectioning technique. One glance into the microscope with the basidium centered and in focus and he immediately announced his mistake to the class amidst great humility and humor. “Oh So Sorry”, he kept repeating, “Oh So Sorry”, in an accent steeped in the memory of countless hot and sour soups, demonstrating that our past shapes both muscular (formation of phonemes) and cognitive (structure of ideas) pathways in the brain..

In this case the interaction of all three memory processes (Perceptual, STM and LTM) can be seen working together under the control of consciousness. I was looking for one type of cell division (transverse) in my visual field. Another unexpectedly popped up (longitudinal). I grabbed it from my Sensory Store. From the LTM, an image (of longitudinal walls from a line drawing)*, a snippet of words and terms (Basidium, Phragmo, cetes, alles) and another image (of a flow chart outline from previous lectures) allowed me to consciously grasp the meaning of what I was looking at. (*see Moore-Landecker Fig. 5-20 p211 for a good line drawing)

These discrete bits of information that I was concentrating on coalesced and formed a meaningful pattern – a gestalt – of “Tremella foliacea” which merged effortlessly with my field concept of that species. Once processed in STM, the residue of this construction was then returned to the LTM bank where it was re-stored in its altered form… which I drew upon for this example which you are now reading.
As I move along to the next paragraph of this article, the reconstructed memory (as presented above) will return to LTM, this time in its newly altered form. Memories and perceptions are thus continually recreated within this perceptual cognitive process, older memories and perceptions incorporated within the newer ones which in turn serve to shape the perceptions and memories yet to occur.

Mistakes happen
Before we move on to some of the details of LTM, another example shows how corruption within the STM process can lead to misidentification of mushrooms. This example was given to me a few years ago by a well known mycologist who had submitted several slides for a popular field guide under construction. Far along in the process it was discovered that one of the slides was grossly misidentified. His reputation as a meticulous craftsman allowed it to pass scrutiny for some time, but fortunately the mistake was caught in time prior to the final proofs.

He was absolutely crushed; humiliated that such sloppy work had tarnished his reputation. As we talked and he went over details of the mistake the following account emerged. He said he was under a publishing deadline and contrary to his usual practice was working on several specimens at the same time. He had a lot on his mind and two slides on his desk. Somehow the details of each were mixed up. As he went over his story, it sounded completely plausible, and familiar, sort of like using the remote to keep track of two simultaneous football games on separate TV channels. Within a few minutes the games become hopelessly entangled.


Memory and Meaning
With some modifications, the chief theory of how memories are stored within the cerebral cortex builds upon the idea of a “memory trace”, and is analogous to aspects of artificial intelligence wired into the computer. (see engram in Wiki or Smith, Hebbian theory)

In this theory “memory traces” are etched into “reverberating cell circuits” of neural firing. These circuits assemble into consolidated networks of many integrated cells. A particular memory can be retrieved by activating the circuitry at any of the intersecting nodes. This is a theory well suited to our more mechanistic, deterministic, or “logical” memories. At its heart is an explication of an either-or, on-off, binary encoding system. A cell fires and sends a 40 millivolt charge along its trunk-like axon. At the axon’s terminus this charge is converted into a chemical neurotransmitter which jumps the synaptic cleft and activates the next cell in the chain. This is an all or none act. Either the next cell fires or it doesn’t.

The integrated activity of these neural networks gives rise to concrete behavior. With the addition of symbols to the cognitive mix, it leads to implicit trial and error activity within the brain, an activity we often call abstract meaningful thought

Just a reminder for those of us who might have forgotten the distinction: Signs refer to events in the immediate present, the “here and now”. Symbols are internalized representations and allow us to think about events that we cannot see, even events that have no physical existence, such as irrational numbers, fairy godmothers, heaven, hell, or as recent mycological evidence seems to suggest, Amanita virosa. (See Kuo 2003, October, for more about the disappearing virosa.)

The meaning of meaning:
Language is symbolic activity. For psychologists and semanticist, the “meaning of Meaning” has to do with “associational value”. The more associations – references- a symbol has, the more meaning it has. A particular meaning/memory can be triggered by stimulating anywhere along the cell circuit. For example, a glimpse of a basidium with two instead of four sterigma, the “apparent ratio” of two to four spored basidia, or the “development of spore size and basidia as a function of both maturation within the hymenium and seasonal changes within the sporocarp” may all trigger the symbolic memory of “Amanita virosa” or “Amanita bisporigera”.

The full meaning of what we may have collected will depend upon our understanding of the work of others who have painstakingly sifted through reams and reams of “referents” to the symbolic ideal of a “type specimen” that physically sits in a labeled box in a specific herbarium, or perhaps exists nowhere at all save the array of symbols on pages sewn within books, magnetically distributed across arrays of semiconductors, or within the neural networks of individuals like you, me and the authorities to whom we refer.

When we think of a “species” we are thinking of an “abstract ideal” that does not exist in the “real world”. When we think of a species, we are thinking of a concept. And specific concepts will usually lie embedded within larger ones with smaller ones yet nested inside. The concept of “A. farinosa” for example, lies embedded within “Section Amanita” of “Genus Amanita”. When first described by Schweinitz in 1822 it was placed in Pluteaceae. Earle and Atkinson in 1909 and 1908 placed it in Amanitella and Amanitopsis of Amanitaceae respectively. (Index Fungorum 2007 Amanita farinosa)

The concept of “A. farinosa” has changed throughout the years, even though in its bare outlines this is a fairly easy organism to identify in the field. Jenkins, in part, describes it in the following way:
“This is one of the more distinctive organisms in the section Amanita, being characterized by having a relatively small stature, a plicate-striate pileus margin, and a brownish-gray to dark gray, pulverulent volva. This volva is found as a thin layer on the pileus and a distinct ring at the top of the basal bulb.”

The concept changes when we move it under the microscope and include references such as these as described by Tulloss (Feb. 07)
“The exannulate stipe is 45 - 60 x 4.5 - 8 mm. The small bulb (5 - 8 x 8 - 9 mm) bears a powdery area of universal veil on its upper surface that is usually quite distinct. The spores measure (6.0-) 6.5 - 8.8 (-10.5) x (5.0-) 5.5 - 7.0 (-9.0) µm and subglobose to ellipsoid (infrequently globose or elongate) and inamyloid. Clamps are not present at bases of basidia.”

And in recent literature, Montcalvo, et al. (2000) refer to “Amanita farinosa” in part as follows:
'Amanita farinosa RV96/104' NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAAAAGAAACTAACAAGGAT-CCCTTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTGAAATCTGGCAG------------TGTTTTACTGCTCGAGTTGTAATCTAGAGAAGTGTT-ACCCGTGCTGGACCATGTACAAGTCTCCTGGAATGGAGCATCATAGAGGGTGAGAATCCTGTCTTTGACATGGACTACC-AGTGCAATTGTGGT-GTGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCAAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACACTTAAAGTCAGTG--ATGTCGGC-CAGGGATCAAGTCCGCATTTTTTAAATGC-TGGGT-GTACTTCCTGAT---CTGACAGGTCAACATGAGTTTTGACTGCTGGAAAA-GGATTGGGGGAATGTGGCACCTTC----GGGTGTGTT-ATAGCTCTC-TATCAAATGCAGTGGTTGGGACTGAGGAAGGCAGCACGCC-ACAA--GGCCGAG---TTT---CGACTACGTT-CGTGCTGAGGATGTTGGC--ATAATGGCTTTAATTGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGGCTGCGAGTGTTTGGGTGGT-AAACCCTTGCGCGGAATGAAAGTGAAAAGTTTCGATCCC-TGTCAT---AGGGAGCATTGATGCCCGGACCTGAGC-TTTT-AGCAAAGGATCTGCGGTAGAGCAAGCATGTTAGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCAAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAGCTC [ ATGTGTCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCACTTGATTGGACTGCTCGGACAATTGAAA-CTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATTT-GGATGAA-CAACT ]

The abstract symbolic character of this DNA analysis is startling because for most of us these sequences of ‘A’s, ‘T’s, ‘G’s, and ‘C’s have little meaning - few associations- even though we know they refer to specific proteins upon which the genetic code is based.

Operational Definitions
For a taxonomist, systematist, or scientist, these different ways of describing “A. farinosa” refer to sets of specific manipulations called “operational definitions”.

Here are four operational definitions for the identification of mushrooms:
1. We can refer to gross morphological characteristics visible to the naked eye; the Freisian classification system. (Pick it up, turn it over, look at it…)

2. We can enhance our observations by referring to microscopic and/or chemical changes that we can see with aid of instruments. (With a razor blade slice a thin section, place this on a slide, apply a drop of Meltzer’s, and cover with a thin cover slip. Squash gently and observe under increasing magnification…).

3. We can refer to computer printouts of DNA analysis of material (drawn from specific parts of specific organisms which are purified and bulked up by repeated heating and cooling cycles in the presence of specific sugars, proteins, and enzymes until enough has been created by this PCR technique to place in a gel. Subject the gel to electrophoresis and pass through a visualization system after cooling…)

4. For some organisms, although apparently not for Amanita, we can refer to mating characteristics*. (Prepare rose agar. After sterilizing in an autoclave, and cooling, inoculate on opposite ends of the Petri plate with two differing strains. Under sterile conditions, grow them out for several days and observe for compatibility at the juncture of the two hyphal colonies…)
*As Michael Kuo puts it “Mating studies…are out of the question, since amanitas do not mate in culture like the rest of us"

These differing methods have different referents and therefore different meanings. Ergo, when you change the operational definition of a concept, you change the meaning of the concept itself. The organism – the external reality - of course remains unchanged. This is not intended an exercise in solipsism, but since language is the hinge between the inner world of the thought process and the outer world of “objective reality” a deeper look at how language structures our thought patterns bears investigation.

Language and the Structure of Reality
A good summary of this “Tyranny of Words” is given by Stuart Chase (1955) in his book of the same name. In it he summarizes these first seven semantic postulates of Alfred Korzybski’s Science and Sanity.

1. No two events in nature are identical. This proposition is accepted by modern scientists. It runs counter to the "is of identity" in Indo-European languages, and to the "A is A" of formal logic.
2. Nature works in dynamic processes. Accepted by modern scientists and by some schools of philosophy. It disagrees with the linear, cause-and-effect structure of our language.
3. Events flow into one another in nature by "insensible gradations." Nature is all of a piece, though our language tends to separate it into classes.
4. Nature is best understood in terms of structure, order, relationships. Einstein helped to establish this through the principles of relativity. Indo-European languages, with substantives, entities, absolutes, are at odds with the proposition.
5. Events in nature are four-dimensional. Modern physicists think in terms of space-time. Indo-European languages are structured for three dimensions, and those who speak them have great difficulty with the concept of time.
6. Events have unlimited characteristics. Our languages leave many of them out and thus often distort a judgment.
7. There is no simultaneity in nature. Western languages assume it as a matter of course.

You may want to read those again, as they are crucial for the following discussion.

I hope that our “Dear Reader” is still with us and has an appreciation for the power and effect of language in our attempt to parse reality. We do it so easily. As brain scientist Noam Chomsky puts it we have an innate “Language Acquisition Device” built into our nervous tissue. We all pick up a language and, as a child, do it effortlessly. Fish swim, birds fly and humans speak. (Chomsky in Gale)

Think of our brain as a computer, not quite a “blank slate” but one capable of being greatly modified by language structures. Brains programmed with one set of linguistic formulations have great difficulty with deciphering other linguistic programs, much like the “Macintosh Language System” and the “Quick and Dirty Operating System” have problems with one another. Both are valid languages, but appear to be better suited for different purposes.

And just as Macs and PCs have a different language they have a different fan base, so too do different mushroom identification schemes. Those of us who are more comfortable with field work and “floristic analysis” will probably favor the language of the Friesian model. Those schooled in microscopic analysis will refer to the classical monographs of Smith, Thiers, Jenkins, Tulloss and Redhead. Those who work with living cultures will favor breeding experiments and the language of Mayr’s Biological Species Concept. (Biological Species in Answers.com) Those who love the sophisticated power of computer analysis will gravitate towards cladistics, statistics, and cluster analysis.

Another way of saying this is that the different operational definitions of Amanita farinosa are all equally valid but useful for different purposes. The Friesian definitions are best suited for field work while DNA analysis is best suited for showing evolutionary relationships between “farinosa” and other Amanita.

And as each conceptual scheme has its benefits, it also has its share of problems.
Earlier in this article we looked at some of the problems inherent in using similarity, contiguity, continuity and closure as the basis of our field and laboratory classification schemes.

Concepts of species that use breeding compatibility also have their own unique problems. Think, for example of the American Buffalo. Here is an organism that not only has mated with different species, but with a species from a different genus, (Bison and Bos) leading not only to the commercial “beefalo” but also to a dwindling stock of genetically pure native stock. (Robbins 2007)

Or, at the other extreme, think of the “ring species” of various birds (such as the Great Tit, Parus major, or the Larus gulls.) These are a single species (or are they interbreeding “hybrids”?) that are spread across great arcs of territory, from the arctic to the tropics, or around Polar Regions. All along the arc they freely and easily interbreed until the ends of the spectra meet. Here interbreeding is unsuccessful.(For more see http://www.answers.com/topic/ring-species)

Poke around a bit on the web within the area of the “species problem” and you will find enough material to occupy you for days. Here is a good place to start. http://www.answers.com/topic/species-problem

The issue has been extensively discussed for years, spilling across pages and pages of text. As you peruse this mountain of material, you are likely to end up sharing the opinion of Pigliucci (2003) who concludes, “First, the species problem is not primarily an empirical one, but it is rather fraught with philosophical questions that require-but cannot be settled by-empirical evidence.”

Still, the heart and soul holds out for something firmer than metaphysics. We do crave permanence that we can sink our teeth into, and in our case of mushrooms, an identification that holds constant, that “is real and final”. For many of us DNA evidence seems to hold out that promise. In Part three of this series we will have a look.



The first installment of this three part series can be found at http://web.mac.com/diannasmith1/FUNGIPHOTOS/BILL_BAKAITIS_Articles/Entries/2009/7/29_PSYCHOLOGICAL_FACTORS_INFLUENCING_THE_IDENTIFICATION_OF_MUSHROOMSBy_Bill_Bakaitis.html or in Mushroom, The Journal of Wild Mushrooming Spring 2010


REFERENCES CITED
Answers.com, Biological Species
http://wiki.answers.com/Q/What_is_the_biological_species_concept_of_Ernest_Mayr
Answers.com, Species Problem http://www.answers.com/topic/species-problem
Answers.com; Ring Species: http://www.answers.com/topic/ring-species

Chase, S. Tyranny of Words: THEOSOPHY,Vol. 43, No. 5, March, 1955 (Pages 206-
210; http://www.wisdomworld.org/additional/WordPuzzles-Series/Part20of29.html)
Chomsky in Gale : http://www.chomsky.info/bios/2001----02.htm
Deadwyler,S. Hampson,, R. “Two Brain areas Critical for Short Term Memory” Sam
Deadwyler, Ph.D, Robert Hampson, Ph.D.; Wake Forest University Baptist Medical
Center http://www.newswise.com/articles/view/504863/
engram (in Wikipedia) http://en.wikipedia.org/wiki/Engram_(neuropsychology)
Gregory, R. L. 1997. Eye and Brain: the Psychology of Seeing, 5th ed., Princeton
University Press, Princeton, NJ.
Jenkins, D. 1986. Amanita of North America. Mad River Press. Eureka, CA.
Index Fungorum Partnership 4/17/07 Amanita farinosa
http://www.speciesfungorum.org/Names/NamesRecord.asp?RecordID=355585
Kuo, M. (2003, October). The destroying angel: Amanita bisporigera
http://www.mushroomexpert.com/amanita_bisporigera.html
Largent, D., D. Johnson, and R. Watling. 1977. How To Identify Mushrooms To Genus
III: Microscopic Features. Mad River Press; Eureka, CA.
Miller, G (in Wikipedia)
http://en.wikipedia.org/wiki/The_Magical_Number_Seven,_Plus_or_Minus_Two
Moore-Landecker, E. 1982. Fundamentals of the Fungi, 2nd. ed. Prentice-Hall
Moncalvo, J.-M., D. Drehmel, and R. Vilgalys. 2000 Variation in modes and rates of
evolution in nuclear and mitochondrial ribosomal DNA in the mushroom genus
Amanita(Agaricales, Basidiomycota): phylogenetic implications. Molecular hylogenetic
and Evolution 16(1):48-63.
http://www.biology.duke.edu/fungi/mycolab/publications/AMANITA_nLSU+mtSSU.PAUP.
Pigliucci, M. (2003). "Species as family resemblance concepts: the (dis-)solution of the
species problem?" BioEssays 25: 596-602
Robbins, J. 2007. “Out West, with the buffalo, roam some strands of undesirable DNA”
The New York Times, Jan. 9, 2007.
STM Wikipedia: http://en.wikipedia.org/wiki/Short-term_memory
Sperling, G. 1960 The Information available in brief visual presentations Psychological
Monographs: General and Applied, 74 (11, Whole No 498) p 1—29 online at
http://aris.ss.uci.edu/HIPLab/staff/sperling/PDFs/Sperling_PsychMonogr_1960.pdf
Smith, D 2004, hebbian theory http://www.smithsrisca.demon.co.uk/hebbian-theory.html
Tulloss, R.E. Feb 07 “Amanita farinosa Schwein. page of sect Amanita"
( http://pluto.njcc.com/~ret/amanita/species/farinosa.html
Wood, S. E. and E. G. Wood. 1996. The World of Psychology, 2nd ed. Allyn and Bacon, Needham Heights, MA. This happened to be a text on my desk as the first drafts of this article were being written. Having reviewed dozens of such texts each year as part of my professional duties I can say that almost any intro Psych text will do. In this field the content has become very standardized and consistent.